FAQ

Search Discussions

62 discussions - 371 posts

  • hello! i want to input some numbers via <stdin in while loop.And loop should be broken if any nonnumeric character is entered.So how it can be checked. ........................ ...
    Anant mittalAnant mittal
    Aug 22, 2011 at 5:45 am
    Aug 30, 2011 at 3:30 pm
  • I have a file that contains records of customer interaction The first column of the file is the batch number(INT) , and other columns are date time , close time etc etc I have to sort the entire file ...
    Ramprasad PrasadRamprasad Prasad
    Aug 7, 2011 at 3:28 pm
    Aug 8, 2011 at 2:59 pm
  • Hi! I want to search whether a scalar '$a' contains any one of value of an array '@arr'. How it may be done? as its not correct : print "found" if $a =~ /@arr/;
    Anant mittalAnant mittal
    Aug 22, 2011 at 6:25 am
    Aug 22, 2011 at 8:30 pm
  • This works! Is there a way to do it with less typing? How can I do it without creating a temporary variable "@p"? Thanks, siegfried find /xyz -exec perl -e 'foreach(@ARGV){ my @p=split "/"; rename ...
    SiegfriedSiegfried
    Aug 11, 2011 at 11:17 pm
    Aug 18, 2011 at 1:53 pm
  • Hello All, I would like to know how to access character from string lateral. Say I have $foo = "From Big Brother Africa"; I would want to print each of the characters of $foo on its own. In some ...
    EmekaEmeka
    Aug 1, 2011 at 12:14 pm
    Aug 2, 2011 at 5:34 pm
  • Hi all, I have a string like *"abcd efgh ijkl mnop"* i want to reverse the string like this "*dcba hgfe lkji ponm*" can any one tell me how to get the required output? thanks in advance...... -- ...
    Narasimha MadineediNarasimha Madineedi
    Aug 30, 2011 at 2:53 pm
    Aug 30, 2011 at 7:10 pm
  • Recently, I was asked to find the first occurrence of a word in a text file and replace it with an alternate word. This was my solution. As a new Perl programmer, I feel like this solution was too C ...
    Ron WeidnerRon Weidner
    Aug 21, 2011 at 11:33 am
    Aug 23, 2011 at 5:00 am
  • Hi everybody, I was wondering, if it is possible to use backreferences in the pattern repetition bracket operator. Consider the following string: my $string = "5 abcdefghijklmn"; The number five at ...
    Honza MachHonza Mach
    Aug 25, 2011 at 8:42 am
    Aug 25, 2011 at 7:21 pm
  • How can I do a 3-argument open on STDIN? This doesn't work because the 3-argument open won't open STDIN when you tell it to open "-". ************************************** @files = ("-"); for ...
    Bryan R HarrisBryan R Harris
    Aug 17, 2011 at 9:40 pm
    Aug 23, 2011 at 11:25 pm
  • I have a new debian install and am continuing to learn perl. Whilst I know I should use perlbrew to keep my perl version separate from my system version is there anyway to sandbox the perlbrew ...
    FlebberFlebber
    Aug 29, 2011 at 5:02 pm
    Sep 1, 2011 at 11:04 am
  • Hello All I tried this in order to install Perl-tk cpan install tk ... But it failed to work. Emeka -- *Satajanus Nig. Ltd *
    EmekaEmeka
    Aug 23, 2011 at 10:04 pm
    Aug 25, 2011 at 7:27 am
  • What is the correct way to quickly assign the result of a regex against a cmdline arg into a new variable: my $var = ($ARGV[0] =~ s/(.*)foo/$1/i); Obviously that's incorrect but is there a quick way ...
    Joseph L. CasaleJoseph L. Casale
    Aug 16, 2011 at 6:28 pm
    Aug 17, 2011 at 6:10 am
  • Hello, I have been scratching my head on this problem and was wondering if someone can help me out. Basically I need to take a raw list of data (a snippet of it is below my email) and create another ...
    Ryan LagolaRyan Lagola
    Aug 4, 2011 at 1:38 am
    Aug 6, 2011 at 6:29 pm
  • Assume I have to find the first unique character in a string $string = "abtable"; # t is the first unique string I tried using a negative backtrace lookup to get the answer in a single regex ... But ...
    Ramprasad PrasadRamprasad Prasad
    Aug 24, 2011 at 2:54 pm
    Aug 26, 2011 at 6:01 pm
  • Hi All, I am working on the below code to traverse through a hash, but it throws an error which states "Can't coerce array into hash at temp.pl line 6." Code: ...
    Anand JawajiAnand Jawaji
    Aug 23, 2011 at 9:23 am
    Aug 25, 2011 at 5:38 pm
  • foreach $str1 (@arr1){ foreach (@arr2) { @arr3 = split(/ /,"$_"); print "array = @arr3 element0 = $arr3[0] element1 = $arr3[1]"; #this is just to check, it showing values 0 and 1 as correctly ...
    Rajeev PrasadRajeev Prasad
    Aug 17, 2011 at 12:38 am
    Aug 19, 2011 at 10:32 pm
  • can you reference elements of an array/hash from within that array/ hash for example would @array=(A, B, C, D, $array[0], E, F) fly? Zak
    ZakZak
    Aug 18, 2011 at 2:52 pm
    Aug 19, 2011 at 5:26 am
  • I believe you can sort an array like so: sort @my_array; I need to sort a string though. I have $a_string that contains: 4565 line1 2345 line2 500 line3 etc. Obviously \n is at end of every line in ...
    MattMatt
    Aug 16, 2011 at 4:04 pm
    Aug 17, 2011 at 11:25 pm
  • Hello all! My first question in this group =) Can someone explain me why this work fine: #!/usr/bin/perl -w sub func { return 10; } print 5 * func, "\n"; The answer is 50. Good! But then i change ...
    TimKapHwanTimKapHwan
    Aug 12, 2011 at 12:05 pm
    Aug 14, 2011 at 4:38 am
  • Hi there Sure I am the newbiest of all Perl newbies in this group .... Just have been reading some of the posts you all have sent since I subscribe to this list What I'm trying to learn these days is ...
    Jose MarquezJose Marquez
    Aug 3, 2011 at 4:49 pm
    Aug 5, 2011 at 2:34 pm
  • Hi everyone i am a beginer for Perl can you give me a psedocode and a sample code for a spider program.It will be helpful in understanding web interfaces.Thank you -- VinoRex.E Research Scholar ...
    VinoRex.EVinoRex.E
    Aug 1, 2011 at 10:03 am
    Aug 3, 2011 at 10:10 am
  • Hi i am a beginner in Perl i have a pdb file containing the X,Y,and Z coordinates of atoms example given below. the data extends upto 1000 atoms and its coordinates. I need a perl program to export ...
    VinoRex.EVinoRex.E
    Aug 4, 2011 at 9:03 am
    Aug 4, 2011 at 3:58 pm
  • hi all, i want to open some files in a directory, you can see the details below, #!/usr/bin/perl -w use strict; opendir (FH,'C:\Player'); chdir 'C:\Player'; for my $file(readdir FH) { open ...
    HomedwHomedw
    Aug 1, 2011 at 7:09 am
    Aug 1, 2011 at 8:50 am
  • Hello It has been a while since I have done some serious Perl programming. I am looking for a basic script that will take a very large file and split it up into a manageeable files that can be ...
    AndrewmchorneyAndrewmchorney
    Aug 30, 2011 at 6:51 pm
    Aug 31, 2011 at 2:06 pm
  • Hello All, I am thinking of check out GUI ... so I would need to know where to start off. Is there a GUI module with Perl? Or am I going to pull one from web? Emeka -- *Satajanus Nig. Ltd *
    EmekaEmeka
    Aug 23, 2011 at 11:23 am
    Aug 23, 2011 at 12:44 pm
  • . . . while(@dat = $sth- fetchrow) { print "@dat\n"; . . . This code works yet there is no 'my @dat' defined anywhere in the code. Using Perl 5.8.x - 5.14.x Q: Why does the variable @dat not need a ...
    Tony EspositoTony Esposito
    Aug 12, 2011 at 7:02 pm
    Aug 12, 2011 at 7:18 pm
  • Hi all, Even though in most cases I use Perl in production under Linux, I use to develop the programs under Windows, and until now I used Perl only under Windows XP. Do you know if Perl works fine ...
    Octavian RasnitaOctavian Rasnita
    Aug 11, 2011 at 5:27 am
    Aug 11, 2011 at 7:13 pm
  • Hi every one i am a Biologist,i am having a DNA file having 2000 to 10000000 letters. eg file:(ATGCATGCTAGCTAGTCGATCGCATCGATAGCTAGCTACGCG CGTACCGTGCAGAAGAGCAGGACATATATATTACGCGGCGATCGATCGTAGC ...
    VinoRex.EVinoRex.E
    Aug 10, 2011 at 10:49 am
    Aug 11, 2011 at 6:11 am
  • I'm trying to sort a shopping cart basket on the item numbers. The basket is stored in a hash. There is a hashref called %{$main::global- {cart}} that Data::Dumper prints out like so: $VAR1 = { '1' = ...
    MarcMarc
    Aug 3, 2011 at 6:12 pm
    Aug 4, 2011 at 1:38 am
  • I am using Strawberry on WinXP. I need to test some IPv6 connectivity but can't get Socket6 to install. It all boils down to two errors during the compile stage. Socket6.o:Socket6.c:(.text+0xa47): ...
    Bob McConnellBob McConnell
    Aug 23, 2011 at 8:01 pm
    Aug 24, 2011 at 3:14 pm
  • Hello all, I am beating my head against the wall, any help would be appreciated. I have a file: / / / / m / cvfbcbf/ A123/ / / /// //// / / / / m / cvfbcbf/ A234/ / / /// //// / / / / m / cvfbcbf/ ...
    ERIC KRAUSEERIC KRAUSE
    Aug 17, 2011 at 9:59 pm
    Aug 18, 2011 at 9:59 pm
  • Without a root permission, I can't install perl module through normal way such as CPAN. But I have to use this module(XML::Quote). I have tried to copy the .pm file to my own lib directory directly, ...
    Universe sheepUniverse sheep
    Aug 16, 2011 at 4:02 pm
    Aug 16, 2011 at 5:26 pm
  • My service is published by J2EE , it's use SOAP and RSA jks encrypt (serverStore.jks and clientStore.jks). I need to use PERL to invoke the webservice . Could you do me a favor, offer an example ...
    王璟王璟
    Aug 8, 2011 at 2:45 am
    Aug 9, 2011 at 2:36 am
  • Hi, I have wrote a module and released it with module-starter. (http://search.cpan.org/~xsawyerx/Module-Starter-1.58/lib/Module/Starter.pm) When I install it from the CPAN shell, how can I make the ...
    Feng HeFeng He
    Aug 5, 2011 at 1:12 am
    Aug 5, 2011 at 10:03 am
  • I have forgot that, is there a //= operator in Perl? which should do the same stuff as: unless (defined($foo) ) { $foo = ...; } Thanks.
    Terry pengTerry peng
    Aug 3, 2011 at 5:32 am
    Aug 3, 2011 at 6:37 am
  • Hello all, I am receive the unintialized value in number lt (<) at error when running the below perl script. The error is indicated on line 34. The challenge I face is that this script was written by ...
    Jason ForgetJason Forget
    Aug 2, 2011 at 1:09 pm
    Aug 2, 2011 at 6:59 pm
  • I downloaded the Tk module. Unpacked it by zcat Tk800.0_01.tar.gz | tar xf - then cd to that directory (cd Tk-804.029_500) then perl Makefile.PL and I got this output: ...
    Chankey PathakChankey Pathak
    Aug 11, 2011 at 7:29 am
    Aug 26, 2011 at 6:21 pm
  • Hello All, I want to re-size and edit images. Which module would you advise? Emeka -- *Satajanus Nig. Ltd *
    EmekaEmeka
    Aug 25, 2011 at 11:33 pm
    Aug 26, 2011 at 1:14 am
  • In the program below the "for loop" is causing the warning... "Useless use of private variable in void context at ./uselessUse.pl line 16." If I comment out the "for loop" like this the warning goes ...
    Ron WeidnerRon Weidner
    Aug 20, 2011 at 2:11 pm
    Aug 20, 2011 at 2:36 pm
  • Hello all, I posted this question in the bioperl forum- no replies after a day, so let's see if anyone here can help. I wrote a short test script for the Bio::DB::Taxonomy module: ...
    ANJAN PURKAYASTHAANJAN PURKAYASTHA
    Aug 16, 2011 at 3:00 pm
    Aug 16, 2011 at 3:58 pm
  • Hi all, When converting a single number (eg 6) to its binary format using unpack as in: unpack 'B8', '6'; # output = 00110110 I get the 8 character output 00110110. Does unpack have options for it to ...
    Th0ma5_anders0nTh0ma5_anders0n
    Aug 14, 2011 at 7:58 am
    Aug 14, 2011 at 11:00 am
  • I'd like to include code so that if I get the following error, the script will just ignore it and keep running: "Can't call method "attr" on an undefined value at abcde.pl line 2" Does anyone know of ...
    Jeffrey JohJeffrey Joh
    Aug 12, 2011 at 11:58 pm
    Aug 13, 2011 at 2:33 am
  • dear all, i want to make some search and replace within a string where I can define a set of characters, especially parenthesis, brackets etc., which are to be ignored. For example, I have the ...
    Frank MüllerFrank Müller
    Aug 8, 2011 at 2:31 pm
    Aug 11, 2011 at 6:57 am
  • Hi, I made the following test script: use strict; use warnings FATAL = 'all'; use LWP::UserAgent; my $fields; my $ua = LWP::UserAgent- new; my $res = $ua- get( 'http://www.google.com/', %$fields ); ...
    Octavian RasnitaOctavian Rasnita
    Aug 7, 2011 at 9:28 am
    Aug 7, 2011 at 3:16 pm
  • The simpliest questions don't seem to have readily available answers: I need a hardware recommendation! I use Perl on my own machine to assemble HTML files (no networking stuff). My current machine ...
    SbSb
    Aug 5, 2011 at 12:05 am
    Aug 5, 2011 at 12:46 am
  • I'm thinking about testdriveing XAMPP. Does anyone have any opinions on the product? Good or bad? http://www.apachefriends.org/en/xampp.html Thank you, Chris
    Chris StinemetzChris Stinemetz
    Aug 4, 2011 at 4:34 pm
    Aug 4, 2011 at 4:53 pm
  • hi folks hi guru of perl in the examples of Net::SSLeay, it shows various examples that use low-level functions use Socket. what are the differences if we re writing the examples with IO::Socket::SSL ...
    MlMl
    Aug 3, 2011 at 12:05 am
    Aug 3, 2011 at 1:27 am
  • Hi all, I have several *nix version of Unix and while some I can use df -h, for some I can't. The only common thing that I can use that works for all is df -k. ...
    Newbie01 perlNewbie01 perl
    Aug 1, 2011 at 8:54 am
    Aug 2, 2011 at 9:38 pm
  • How can I open multiple FIFO files in perl and print to them simultaneously I tried a simple script does not work #!/usr/bin/perl use strict; use IO::File; $|=1; system("rm -f /tmp/fifo1;mkfifo ...
    Ramprasad PrasadRamprasad Prasad
    Aug 29, 2011 at 4:29 pm
    Aug 29, 2011 at 4:58 pm
  • Hello All, Why shouldn't this work? use Getopt::Long; #$debug = 0; $result = GetOptions("age=i" = $age); if ($age) {print "Input age is $age years"; } Emeka -- *Satajanus Nig. Ltd *
    EmekaEmeka
    Aug 23, 2011 at 9:53 pm
    Aug 23, 2011 at 10:23 pm
Group Navigation
period‹ prev | Aug 2011 | next ›
Group Overview
groupbeginners @
categoriesperl
discussions62
posts371
users91
websiteperl.org

91 users for August 2011

Rob Dixon: 34 posts Shlomi Fish: 26 posts Shawn H Corey: 25 posts Emeka: 20 posts John W. Krahn: 17 posts Timothy adigun: 15 posts Jim Gibson: 14 posts Uri Guttman: 13 posts Shawn wilson: 12 posts Brandon McCaig: 11 posts Dr.Ruud: 8 posts Marc: 8 posts Randal L. Schwartz: 8 posts Alan Haggai Alavi: 7 posts Ramprasad Prasad: 7 posts Octavian Rasnita: 6 posts Paul Johnson: 6 posts Rajeev Prasad: 6 posts C.DeRykus: 5 posts Feng He: 5 posts
show more
Archives