FAQ

Search Discussions

371 discussions - 1,576 posts

  • I am reading in a file of one line sentences, and then selecting to store several sentences into an array based upon the presence of some key words. I then want to assign the array to a hash. The ...
    Stuart WhiteStuart White
    Jun 2, 2003 at 9:02 pm
    Jun 7, 2003 at 5:13 pm
  • Thanks, Rob. Is there anywhere I can find other special cases? I was so happy when I learned about split ' '. =) Thanks again. - Bryan
    Bryan HarrisBryan Harris
    Jun 14, 2003 at 4:20 am
    Jun 18, 2003 at 5:23 am
  • Hi all, does anybody knows how to check if a diretory is empty? TIA Jair
    Jair SantosJair Santos
    Jun 5, 2003 at 10:56 pm
    Jun 17, 2003 at 1:11 am
  • Hi to all, I have to compare each line of a very long text file with each line of another one. I stored all the first file lines in an hash - to make the process faster. Now I have that hash with the ...
    Adriano AlloraAdriano Allora
    Jun 18, 2003 at 10:48 am
    Jun 20, 2003 at 4:05 pm
  • Hi! I'm still wallowing in Chapter 3 (Arrays. Why can't I get it?!?!?!? ARGH!!!!!) of Learning Perl on Win32 Systems. I'm trying to create an exercise but I'm not getting the results that I want. ...
    Anthony BeamanAnthony Beaman
    Jun 25, 2003 at 12:23 pm
    Jun 25, 2003 at 6:31 pm
  • Hi, I want to use readdir to read a directory tree & find a certain file, which might be present in many subdirectories (this file will be a trigger to continue of the process). Then I want to define ...
    Ronen KfirRonen Kfir
    Jun 19, 2003 at 8:18 am
    Jun 22, 2003 at 12:47 pm
  • Probably a no-brainer, but I wondered what is the canonical way or possibly a module that does this chore: Identify files by type similar to `-type' flag to unix `find' command. I first thought of ...
    Harry PutnamHarry Putnam
    Jun 7, 2003 at 8:20 am
    Jun 10, 2003 at 9:31 pm
  • (Forgive the excitement) I just reversed the %n2m construct - the original builds a hash using map that lets you convert numbers to months, etc. (I probably found it here). In keeping with my feeling ...
    Kevin PfeifferKevin Pfeiffer
    Jun 5, 2003 at 5:26 pm
    Jun 8, 2003 at 12:05 pm
  • Is there some way that I can write a bit of code that will watch a directory and as soon as a file is written to that directory, something is run against that file? What would be the best way to turn ...
    Chris ZimmermanChris Zimmerman
    Jun 26, 2003 at 6:22 pm
    Jun 30, 2003 at 2:11 pm
  • I've stumbled around with this before and someone posted something that came close but still doesn't quite do what I want. Maybe it isn't important enough to get this involved with it. Here is the ...
    Harry PutnamHarry Putnam
    Jun 28, 2003 at 6:11 pm
    Jun 29, 2003 at 4:41 am
  • Any advice on getting through the LP/Win 32 book? I know I can do it but I'm getting tripped up. I've moved on to other chapters and I'm about to read Chapter 7 but I still haven't gotten arrays and ...
    Anthony BeamanAnthony Beaman
    Jun 25, 2003 at 12:29 pm
    Jun 26, 2003 at 7:56 am
  • hi, how can i use a real regex with this: File::Find::name if -x? the filetestops are working fine, but how can i filter things like .gz$? i tried many ways, but all failed. any idea? thanks!! bye ...
    MagelordMagelord
    Jun 23, 2003 at 7:15 pm
    Jun 24, 2003 at 4:13 pm
  • How do I go about making the output from CPAN::Shell- i; go into a file handle Instead of STDOUT like it does in this formulation: $target = "somefile"; if($opt_r){ open(FH," $target") or die "Cannot ...
    Harry PutnamHarry Putnam
    Jun 28, 2003 at 6:20 am
    Jul 1, 2003 at 12:04 am
  • Hello, I have to get the size and last modified date of a remote file via URL without reading in the whole file. I have gone through LWP::UserAgent but couldn't make much headway. Any pointers on how ...
    Shishir K. SinghShishir K. Singh
    Jun 24, 2003 at 3:40 pm
    Jun 30, 2003 at 10:50 am
  • Hello all, I have finished writing up a neat Perl server which works just fine on Linux. I want to see it work seamlessly on other platforms too (Windows/*Nix) The first issue that I see, is with ...
    Perl_beginnerPerl_beginner
    Jun 13, 2003 at 5:51 pm
    Jun 22, 2003 at 4:49 pm
  • Folks, I have the following block of code: open (CNTFILE, "${OUTPUTFILE}") or die "Can't open ${OUTPUTFILE} : $!"; @FILE=<CNTFILE ; close(CNTFILE); Which reports this warning: Name "main::CNTFILE" ...
    Yacketta, RonaldYacketta, Ronald
    Jun 12, 2003 at 9:15 pm
    Jun 13, 2003 at 4:04 pm
  • Hi all, I have a hash and want to return the first key in the hash. How can I do this? Thanks in advance, Hamish
    Hamish WhittalHamish Whittal
    Jun 12, 2003 at 12:12 pm
    Jun 12, 2003 at 2:02 pm
  • Can you get anythign returned if you get('216.239.51.100')? Is that "company ip address" a public IP address? What is the ip address so I can see if I can see it. If it's public and the script can ...
    Dan MueyDan Muey
    Jun 2, 2003 at 2:58 pm
    Jun 4, 2003 at 2:45 pm
  • Hi All, I wanted to search for *.html file on Server which I can mount in my Windows XP: e.g. I drive mapped to tech\work\web\documents. as I:\tech\work\web\documents now i try to go inside this ...
    Beginner beginnerBeginner beginner
    Jun 30, 2003 at 1:27 pm
    Jun 30, 2003 at 4:08 pm
  • I'm reading an Excel .csv file. Fields are separated by commas. If a field contains a comma, the whole field is double-quoted (Excel does this by default). An example of an input line is as follows: ...
    Sparrow, DaveSparrow, Dave
    Jun 24, 2003 at 10:20 am
    Jun 25, 2003 at 5:18 pm
  • Hi All, I need to retrieve the MAC address of my local system from a Perl script. I'm running RedHat 7.2. Can anyone point me to some sample code for accomplishing this? I've Googled for quite a ...
    AbgAbg
    Jun 19, 2003 at 4:20 pm
    Jun 23, 2003 at 4:34 am
  • I am trying to split off the user name and the password record in one pass through however what I am getting is only the first record is being populated into my user array. Can someone tell me am I ...
    Royce WellsRoyce Wells
    Jun 13, 2003 at 5:02 pm
    Jun 21, 2003 at 5:25 am
  • I'm having a problem with the results of the Unix 'du' command in that I get different results when I execute the 'du' command from the Unix command line... du -sb <directory-path and when I execute ...
    Tony FrasketiTony Frasketi
    Jun 16, 2003 at 9:46 pm
    Jun 17, 2003 at 8:52 pm
  • My script has a function that I want to just print its output in some circumstances but in others I need to capture its output into an array for further processing: sub strip_to_bone { if(/[Ss]ource/ ...
    Harry PutnamHarry Putnam
    Jun 17, 2003 at 3:47 am
    Jun 17, 2003 at 11:27 am
  • I'm trying to execute a perl script with system("sendscript.pl"); I also tried exec("sendscript.pl"); Both of these return Error: No such file or directory The sendscript.pl is in the same directory ...
    MotherofperlsMotherofperls
    Jun 16, 2003 at 4:27 pm
    Jun 17, 2003 at 10:32 am
  • Hi guys (and ladies!), I am trying to write a script to find out the last logon of all users in a domain. I see that with adminmisc I can query a users last logon but this has to be done on every ...
    LeonLeon
    Jun 12, 2003 at 3:34 pm
    Jun 12, 2003 at 10:02 pm
  • I have a hash called fouls. Within that hash, there are other hashes called offensive, personal, and shooting. The keys to those hashes are names, like Smith, Rodriguez, and Chan. and the values to ...
    Stuart WhiteStuart White
    Jun 11, 2003 at 1:06 pm
    Jun 12, 2003 at 2:43 pm
  • Just wondering. After I debug my perl scripts do I still need the strict and warnings flags? Does it hurt performance having them? Does it hurt security removing them? The scripts are for system ...
    Michael WeberMichael Weber
    Jun 4, 2003 at 8:19 pm
    Jun 7, 2003 at 8:00 am
  • well i cant understand what the $1, $2 and $3 do?? herez the code #!/usr/local/bin/perl -w # Get the date in the standard date format. (ex: Tue Oct 24 19:03:03 1995 ) my $date = localtime(); # Search ...
    Saurabh SinghviSaurabh Singhvi
    Jun 5, 2003 at 2:58 pm
    Jun 6, 2003 at 1:00 am
  • This may sound trivial, but I am trying to declare and assign multiple scalars to the same variable in the same statement. This is what I have: #!/bin/perl -w $a = $b = "apple"; # works use strict; ...
    Jeff WestmanJeff Westman
    Jun 4, 2003 at 6:36 pm
    Jun 4, 2003 at 10:18 pm
  • More problems trying to use constants... I have: use constant CFG = qq|$ENV{'HOME'}/.get_quiz|; But I can't see how to make this work: open DATA, " CFG" or die "Couldn't open ", CFG, " for writing: ...
    Kevin PfeifferKevin Pfeiffer
    Jun 1, 2003 at 9:21 am
    Jun 2, 2003 at 11:17 am
  • Is there any methods or documents I can refer to learn how to write a file at any desire position with any length without to write the whole again ? I mean, I dont want to write to a new file, kill ...
    LI NGOK LAMLI NGOK LAM
    Jun 26, 2003 at 2:23 pm
    Jun 29, 2003 at 3:11 am
  • Hi All - This script: use strict; use warnings; my $string = 'I love c++'; my $compare = 'some compare string'; if ($compare =~ /$string/) { print "$compare contains $string\n"; } else { print ...
    Beau E. CoxBeau E. Cox
    Jun 25, 2003 at 3:23 pm
    Jun 25, 2003 at 10:02 pm
  • Does anybody know how to redirect from a perl page with a print "Content-type: text/html\r\n\r\n"; code line? Thank you very much. Miguel Angel ***************************** Madrid 2003 Global IPv6 ...
    Miguel Angel MoralesMiguel Angel Morales
    Jun 25, 2003 at 11:40 am
    Jun 25, 2003 at 5:12 pm
  • A regular contributor to the Perl Quiz Of The Week discussion newsgroup (perl-qotw-discuss@plover.com) is Tassilo von Parseval. His email signature is reproduced below. I have no idea what it does ...
    Sparrow, DaveSparrow, Dave
    Jun 18, 2003 at 9:42 am
    Jun 21, 2003 at 9:05 am
  • Hello faithful list! Has anyone worked with Microsoft Access Databases with perl? I either need to run a query on a remote Access Database or Have the people that have that database save it in CSV ...
    Dan MueyDan Muey
    Jun 17, 2003 at 11:00 pm
    Jun 21, 2003 at 8:54 am
  • Hi All, I'm still a little confused... What is the difference between %{$config_file- {$key}} and %$config_file- {$key} Thanks in advance. H -- Hamish Whittal <hamish@QEDux.co.za QED Technologies cc
    Hamish WhittalHamish Whittal
    Jun 10, 2003 at 10:38 am
    Jun 12, 2003 at 5:31 am
  • Hi: The following is a note from a colleague of which I am skeptical: "fyi.... .pl used to be used for both executables and libraries. A library is simply perl code located in a different file which ...
    Francis HenryFrancis Henry
    Jun 6, 2003 at 3:29 pm
    Jun 9, 2003 at 10:04 am
  • sir please help me with the code which does the following : transfer of files from one system through another system which are both working on linux through ssh as iam in need of it urgently, ...
    Vemulakonda uday bhaskarVemulakonda uday bhaskar
    Jun 26, 2003 at 10:19 am
    Jun 29, 2003 at 4:05 am
  • I am running xemacs on windows. I use it for all of my editing for perl, html, ect... Great editor. However I just started playing with html::mason and I need to install the mmm mode in order to get ...
    Paul KrausPaul Kraus
    Jun 25, 2003 at 2:39 pm
    Jun 25, 2003 at 4:53 pm
  • Hi all, I have a string that is a random sequence like the following:- ACGTCGTCGTCACACACACGCGTCTCTATACGCG I want to be able to parse the string, picking out any TATA sequences, colour them in red and ...
    Robin GarbuttRobin Garbutt
    Jun 23, 2003 at 10:41 am
    Jun 23, 2003 at 11:13 pm
  • Greets, all. This is my first post here... I'm a seasoned C/C++ programmer, and recently started learning perl... it's going along well, and as an exercise, I've completely Perl'ed my webpage. I'm ...
    Abhijit ShylanathAbhijit Shylanath
    Jun 19, 2003 at 7:02 pm
    Jun 20, 2003 at 6:56 pm
  • hello all - I am trying to do the following to this data: input: X|Y||||Z||A desired output: X|Y| | | |Z| |A simply replacing || with | | whereever it may occur in the string. This bit of code ...
    M zM z
    Jun 12, 2003 at 10:34 pm
    Jun 13, 2003 at 10:44 am
  • Hi All: I added the following line to my program: $/ = \65536; This was because I'm running out of memory when slurping entire files into memory (potentially hundreds of meg). However, the (separate) ...
    Rob DasRob Das
    Jun 11, 2003 at 7:48 pm
    Jun 12, 2003 at 3:55 pm
  • Hi, i've got a problem with regexp, i have a multiline string like this is a multi line string and i want to do a regexp that replaces everything that is NOT "a","b","c" or "d" with \s, except \n of ...
    Jaschar OttoJaschar Otto
    Jun 11, 2003 at 9:53 am
    Jun 11, 2003 at 3:25 pm
  • Hi Everyone, I am needing to use some variables throughout all the modules that I have created. I was wondering, bar setting them at the top of each module, what the best means of doing this is. ...
    Hamish WhittalHamish Whittal
    Jun 6, 2003 at 1:49 pm
    Jun 9, 2003 at 5:52 pm
  • Is there any other way to check array uniqueness except the Module Array::Unique? I'm having problems in installing these two Modules: Array::Unique and Tie. So I'm thinking of another way to check ...
    B. FongoB. Fongo
    Jun 30, 2003 at 9:46 pm
    Jul 1, 2003 at 6:14 pm
  • Hi all : Could anyone tell me how I could move between the directories ( or change the present working directory ) with any perl command ?? I have tried these system '/bin/cd $HOME'; , chdir '$HOME'; ...
    T.S. Ravi ShankarT.S. Ravi Shankar
    Jun 30, 2003 at 6:26 am
    Jun 30, 2003 at 11:32 am
  • Hi All I am having a problem with linefeed. I have written a program that writes records to an output file. The program that uses this file as input requires that all records are ended with "\x0A" ...
    Charles ScheepersCharles Scheepers
    Jun 26, 2003 at 8:32 am
    Jun 27, 2003 at 9:27 am
  • What do I need to do in order to use a filehandle that was opened earlier in a program within a subroutine? I've included an example of the code I have that is not doing what I would like. Basically, ...
    Scott, JoshuaScott, Joshua
    Jun 25, 2003 at 6:13 am
    Jun 25, 2003 at 7:18 pm
Group Navigation
period‹ prev | Jun 2003 | next ›
Group Overview
groupbeginners @
categoriesperl
discussions371
posts1,576
users286
websiteperl.org

286 users for June 2003

Dan Muey: 86 posts Rob Dixon: 83 posts John W. Krahn: 79 posts Harry Putnam: 46 posts Jenda Krynicky: 43 posts James Edward Gray II: 41 posts R. Joseph Newton: 41 posts Kevin Pfeiffer: 32 posts Tassilo von Parseval: 31 posts Charles K. Clarkson: 29 posts Janek Schleicher: 29 posts Beau E. Cox: 25 posts Mark G: 25 posts Bob Showalter: 24 posts Paul Johnson: 24 posts Vemulakonda uday bhaskar: 22 posts Stuart White: 19 posts Sudarshan Raghavan: 19 posts Tim Johnson: 19 posts Steve Grazzini: 18 posts
show more
Archives