FAQ

Search Discussions

658 discussions - 2,022 posts

  • I've been a R-user for quite some time. The graphic on the home page looks a bit in need of polish so I applied some antialiased transformations that Peter Dalgaard has previously posted to R-help ...
    Finny KuruvillaFinny Kuruvilla
    Sep 26, 2007 at 2:53 am
    Oct 1, 2007 at 7:41 am
  • Dear All, I know how to export graphics as pdf files and then how to include them in LaTeX documents. However, I do not know how to do in order to have the text of the graphics written with the font ...
    Paul SmithPaul Smith
    Sep 28, 2007 at 11:49 am
    Sep 30, 2007 at 11:24 pm
  • Hi, I have a data set like this: Mutant Rep Time OD 02H02 1 0 0.029 02H02 2 0 0.029 02H02 3 0 0.023 02H02 1 8 0.655 02H02 2 8 0.615 02H02 3 8 0.557 02H02 1 12 1.776 02H02 2 12 1.859 02H02 3 12 1.668 ...
    Marcelo LaiaMarcelo Laia
    Sep 28, 2007 at 5:03 pm
    Oct 2, 2007 at 10:17 am
  • Dear R users, I have started work in a Statistics government department and I am trying to convince my bosses to install R on our computers (I can't do proper stats in Excel!!). They asked me to ...
    Eleni RapsomanikiEleni Rapsomaniki
    Sep 25, 2007 at 10:46 am
    Sep 27, 2007 at 7:19 am
  • Hello! I am using R 2.5.1 on a Apple Power Book G4 with Mac OS X 10.4.10 and I am still R beginner. I try to calculate a t.test() using this code: TTest75<-t.test(Fem75, Mal75, alternative= ...
    Birgit LemckeBirgit Lemcke
    Sep 13, 2007 at 4:01 pm
    Sep 14, 2007 at 2:05 pm
  • Dear all: Is there any one could tell me how I can represent Micro-molar as an unit of concentration when I plot with R(S-plus), I don't want write 'uM' from keyboard, I am thinking to write it like ...
    Zheng LuZheng Lu
    Sep 13, 2007 at 6:47 pm
    Sep 18, 2007 at 9:02 pm
  • Hi, how can I replace NA value with 0: 1991 217 119 103 109 137 202 283 240 146 NA 1992 270 174 149 144 166 239 278 237 275 NA 1993 146 111 104 89 98 131 153 148 175 NA 1994 177 123 146 124 121 200 ...
    Alfredo AlessandriniAlfredo Alessandrini
    Sep 14, 2007 at 8:08 am
    Mar 18, 2010 at 10:20 am
  • Basically new to [R] - as a programming environment at least (had lots of recent experience compiling it on our Opteron-based servers). Was trying to write some simple little scripts (in advance of ...
    Evan CoochEvan Cooch
    Sep 21, 2007 at 4:00 pm
    Sep 24, 2007 at 6:55 am
  • Dear all, I have a variable 'x' like that: [1] "2005-09-01" Here, 2005 represents year, 09 month and 01 day. Now I want to create three variables naming: y, m, and d such that: y = 2005 m = 09 d = 01 ...
    Arun Kumar SahaArun Kumar Saha
    Sep 18, 2007 at 9:00 am
    Sep 20, 2007 at 11:43 am
  • I have the code below and it works fine if I print the xyplot but if I take the print out, then I just get a blank pdf. The same holds if I just send the plot to the console without the print ( I get ...
    Leeds, Mark (IED)Leeds, Mark (IED)
    Sep 11, 2007 at 4:00 pm
    Sep 19, 2007 at 7:50 am
  • I mainly program in Common Lisp and use R for statistical analysis. While in R I miss the power and ease of use of Lisp, especially its many primitives such as find, member, cond, and (perhaps a ...
    Chris ElsaesserChris Elsaesser
    Sep 6, 2007 at 5:26 pm
    Sep 8, 2007 at 2:57 pm
  • Hi R-ers: I need to compute the distance between 2 street addresses in either km or miles. I do not care if the distance is a "shortest driving route" or if it is "as the crow flies." Does anybody ...
    Philip James SmithPhilip James Smith
    Sep 6, 2007 at 6:42 pm
    Sep 7, 2007 at 1:26 am
  • R Community, I've put together a website that I thought this mailing list might be interested in: http://www.r-cookbook.com It's a (free) community-driven content management system for R "recipes", ...
    JeffJeff
    Sep 27, 2007 at 10:09 pm
    Sep 29, 2007 at 6:14 pm
  • Hi everyone, Many of the presentations and posters from UseR! 2007 are now available online: http://user2007.org/program/ If you presented and your slides or poster isn't up yet, please email a pdf ...
    Hadley wickhamHadley wickham
    Sep 4, 2007 at 9:13 pm
    Sep 26, 2007 at 7:05 am
  • Hi All, When I cut & paste help file examples into a script window, about half the time it pastes as a single long line. The steps I follow are: 1. Open a help file e.g. ?data.frame. 2. Select the ...
    Muenchen, Robert A (Bob)Muenchen, Robert A (Bob)
    Sep 20, 2007 at 1:08 pm
    Sep 21, 2007 at 1:23 pm
  • Hi, I have a data frame of 2 columns with the following types : data$day char data$value num And I plot my data with : plot(strptime(donnees$day,format="%Y-%m-%d %H:%M:%S"),donnees$value, type="l") ...
    Ptit_BleuPtit_Bleu
    Sep 17, 2007 at 10:08 am
    Sep 20, 2007 at 7:49 am
  • Hi everybody! I'm new to this list and also to the R program. I'd like to know if there is a function able to convert results into Fractional form like my scientific calculator have. For example: [1] ...
    Mauro ArnoldiMauro Arnoldi
    Sep 13, 2007 at 2:54 pm
    Sep 13, 2007 at 6:44 pm
  • Hello, Some weeks ago, thanks to you, I managed to install R, to connect to a local MySQL Database and to launch some queries with a script written with Tinn-R. My script is now ok and would like to ...
    Ptit_BleuPtit_Bleu
    Sep 10, 2007 at 1:16 pm
    Sep 12, 2007 at 12:35 pm
  • Hi I am currently (for pedagogical purposes) writing a simple numerical analysis library in R. I have come unstuck when writing a simple Newton-Raphson implementation, that looks like this: f <- ...
    Rory WinstonRory Winston
    Sep 3, 2007 at 9:05 pm
    Sep 4, 2007 at 4:49 am
  • Hello all you helpful people out there! I am stil R Beginner using R 2.5.1 on a Apple Power Book G4 with Mac OS X 10.4.10 . Perhaps you haven?t understood my question in the mail yesterday. So I will ...
    Birgit LemckeBirgit Lemcke
    Sep 20, 2007 at 7:49 am
    Oct 8, 2007 at 1:48 pm
  • Hello R, According to: g <- expand.grid(x = 1:10, y = 5:15, gr = 1:2) g$z <- log((g$x^g$g + g$y^2) * g$gr) wireframe(z ~ x * y, data = g, groups = gr, scales = list(arrows = FALSE), drape = TRUE, ...
    MarcgMarcg
    Sep 27, 2007 at 7:21 am
    Sep 28, 2007 at 4:28 pm
  • Is there anyway to plot a matrix using a 3d bar plot. Something like bar3 in matlab? The example in demo hist3d does a 3d barplot for binned data, but has anyone tried something for a simple matrix ...
    StubbenStubben
    Sep 25, 2007 at 6:34 pm
    Sep 26, 2007 at 4:28 pm
  • Hello, I would like to save the results in a specified file name. Here is a test example: aa <- function(xx, newname) { yy <- xx^2 rdName <- file.path(paste(newname, ".RData", sep = "")) ...
    Nitin JainNitin Jain
    Sep 23, 2007 at 1:09 pm
    Sep 24, 2007 at 2:16 am
  • Hi all, I have a time series which contain data collected weekly from week 26 to week 25 the following year. How do I plot this data, so that the x-axis is displaying the week numbers, ordered as in ...
    Gustaf RydevikGustaf Rydevik
    Sep 14, 2007 at 3:31 pm
    Sep 18, 2007 at 3:29 pm
  • I have found two prior instances of this question in R-help, but I can't find the answer, and I'm giving up on mindless tinkering. http://tolstoy.newcastle.edu.au/R/help/03a/5994.html ...
    Gene SelkovGene Selkov
    Sep 7, 2007 at 4:36 pm
    Mar 3, 2008 at 3:02 am
  • Hi All, I just installed Cairo on R 2.5.1 on windows XP. My hope was to get to see the transparency output e.g. http://had.co.nz/ggplot2/stat_smooth.html ggplot2 - stat_smooth , which I finally ...
    Yves MoisanYves Moisan
    Sep 27, 2007 at 3:24 pm
    Sep 28, 2007 at 1:07 pm
  • Just while I use R2Winbugs, the following error will be presented. Please tell me how to cope with. Error in file(file, "r") : unable to open connection In addition: Warning message: cannot open file ...
    Sam_zhzSam_zhz
    Sep 25, 2007 at 7:04 pm
    Sep 26, 2007 at 1:17 am
  • Hi I'm simulating missing data patterns and I've started to get a lot of functions in the same .R file is it possible to store al these functions in a library like one does in C++ (i.e the .h file) ...
    Mauricio MalfertMauricio Malfert
    Sep 25, 2007 at 7:26 am
    Sep 25, 2007 at 3:00 pm
  • Hi R, May be a trivial question, but struggling to find a solution... v=data.frame(a=c("1,234","2,345","5,567")) a 1 1,234 2 2,345 3 5,567 I need a column 'b', which is just the addition of column ...
    Shubha Vishwanath KaranthShubha Vishwanath Karanth
    Sep 24, 2007 at 8:13 am
    Sep 25, 2007 at 8:09 am
  • Hello all, I was wondering if anyone knew how to construct a multiple line graph on R, where there are 2 (or more) sets of data points plotted against some x axis of data, and you can draw a line on ...
    Wayne Aldo GavioliWayne Aldo Gavioli
    Sep 21, 2007 at 1:57 am
    Sep 21, 2007 at 10:57 pm
  • I estimate two competing simple regression models, A and B where the LHS is the same in both cases but the predictor is different ( I handle the intercept issue based on other postings I have seen ...
    Leeds, Mark (IED)Leeds, Mark (IED)
    Sep 13, 2007 at 6:18 pm
    Sep 14, 2007 at 8:41 am
  • Good morning, everyone, I am sorry for this off-topic post but think I can get great answer from this list. My question is what is the best OS on PC (laptop) for statistical computing and why. I ...
    Wensui LiuWensui Liu
    Sep 10, 2007 at 4:22 pm
    Sep 12, 2007 at 2:26 am
  • Hi there! Still struggling to translate Matlab code into R's tsDyn package. Here is my question: Is there in R an equivalent function to Matlab's prctile()? To the moment I thought it was quantile(), ...
    Jose Luis Aznarte M.Jose Luis Aznarte M.
    Sep 11, 2007 at 4:25 pm
    Sep 11, 2007 at 6:01 pm
  • Hello everyone, I wanted to ask what will be a good editor to write R scripts in Fedora 7. Tony
    Antonio_ParedesAntonio_Paredes
    Sep 11, 2007 at 1:36 pm
    Sep 11, 2007 at 3:32 pm
  • I am 100% certain that there is an easy way to do this, but after experimenting off and on for a couple of days, and searching everywhere I could think of, I haven't been able to find the trick. I ...
    D. R. EvansD. R. Evans
    Sep 4, 2007 at 10:14 pm
    Sep 6, 2007 at 7:18 am
  • Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to ...
    João FadistaJoão Fadista
    Sep 5, 2007 at 1:50 pm
    Sep 5, 2007 at 2:40 pm
  • ?wordReport gives a lot of information, but I think it makes us wish for more :-) Where can I find all the ways to write Word documents using R? Namely: (1) is there any way to open a new document ...
    Alberto MonteiroAlberto Monteiro
    Sep 26, 2007 at 2:25 pm
    Sep 26, 2007 at 8:57 pm
  • Dear List, I have an ascii text file with data I'd like to extract. Example: Year Built: 1873 Gross Building Area: 578 sq ft Total Rooms: 6 Living Area: 578 sq ft There is a lot of data I'd like to ...
    Lucy bLucy b
    Sep 25, 2007 at 8:39 pm
    Sep 26, 2007 at 1:50 pm
  • Is there a command to insert a table into the plot area other that using text? Thank you. Luggage? GPS? Comic books?
    Judith FloresJudith Flores
    Sep 21, 2007 at 8:51 pm
    Sep 24, 2007 at 8:33 pm
  • Dear friends, Now, when i use the argument return(x=x,y=y,prob=prob) , R displays the waring message: Warning message: The return value for multiple variables wasn't used in: return(x = x, y = gy, ...
    Zhijie zhangZhijie zhang
    Sep 23, 2007 at 7:53 am
    Sep 23, 2007 at 3:02 pm
  • Dear List, I'm trying to typeset some chemical ions in axis labels. These have both super and subscript components, and for some, I need a superscript "-". In LaTeX I might use $NO_3^-$ to do the ...
    Gavin SimpsonGavin Simpson
    Sep 20, 2007 at 3:54 pm
    Sep 21, 2007 at 11:40 am
  • Hello, I am wondering if it is possible to view what variables and vairable values are stored in the R memory. This to enable debugging of R-scripts I write. Sumit
    Sumit GuptaSumit Gupta
    Sep 12, 2007 at 2:01 am
    Sep 13, 2007 at 1:04 am
  • Dear All, The package mratios can perform inferences for ratios of normal means. Is there some other package to do the same but with non-normal populations. Since I have got large samples, an ...
    Paul SmithPaul Smith
    Sep 11, 2007 at 9:38 am
    Sep 12, 2007 at 11:02 am
  • Hi all, I'm looking for a contributed package that can provide a detailed account of missing data patterns and perhaps also provide imputation procedures, such as mean imputation or hot deck ...
    David KaplanDavid Kaplan
    Sep 11, 2007 at 9:35 pm
    Sep 12, 2007 at 4:03 am
  • Okay, I want to do something similar to SAS proc format. I usually do this... a <- NULL a$divisionOld <- c(1,2,3,4,5) divisionTable <- matrix(c(1, "New England", 2, "Middle Atlantic", 3, "East North ...
    Cory NissenCory Nissen
    Sep 4, 2007 at 2:30 pm
    Sep 8, 2007 at 9:16 am
  • Hi, I tried to load a .RData object on unix system using R, it gives error: Error: restore file may be empty -- no data loaded In addition: Warning message: file 'junk3.RData' has magic number '' Use ...
    Hongxiao ZhuHongxiao Zhu
    Sep 30, 2007 at 6:52 pm
    Nov 19, 2009 at 12:43 am
  • Hello, For my functions I want to create output similar in appearance to that of what you get when you print a summary of lm model: Residuals: Min 1Q Median 3Q Max -0.209209 -0.043133 0.001793 ...
    Sergey GoriatchevSergey Goriatchev
    Sep 28, 2007 at 2:03 pm
    Oct 5, 2007 at 5:07 pm
  • Hello everyone (and Hadley in particular), I often need to plot data from multiple datasets on the same graph. A common example is when mapping some values: I want to plot the underlying map and then ...
    JihoJiho
    Sep 27, 2007 at 10:52 am
    Oct 1, 2007 at 5:53 am
  • Dear All, Can R draw plots of functions on a Cartesian coordinate system with axes like the ones shown at http://en.wikipedia.org/wiki/Image:Cartesian-coordinate-system-with-circle.svg ? I have ...
    Paul SmithPaul Smith
    Sep 28, 2007 at 5:12 pm
    Sep 28, 2007 at 8:12 pm
  • Dear All, Can R plot graphs like the one at http://www.mathwords.com/f/f_assets/floor_graph.gif with the balls at the discontinuity points? Thanks in advance, Paul
    Paul SmithPaul Smith
    Sep 28, 2007 at 12:04 am
    Sep 28, 2007 at 11:49 am
Group Navigation
period‹ prev | Sep 2007 | next ›
Group Overview
groupr-help @
categoriesr
discussions658
posts2,022
users635
websiter-project.org
irc#r

635 users for September 2007

Gabor Grothendieck: 63 posts Jim holtman: 56 posts Duncan Murdoch: 50 posts Prof Brian Ripley: 50 posts Peter Dalgaard: 47 posts Hadley wickham: 37 posts Greg Snow: 35 posts Paul Smith: 33 posts Marc Schwartz: 30 posts Uwe Ligges: 26 posts Vladimir Eremeev: 26 posts Deepayan Sarkar: 24 posts Ted Harding: 22 posts Frank E Harrell Jr: 20 posts Charles C. Berry: 19 posts Ben Bolker: 17 posts Wayne W Jones: 17 posts Jim Lemon: 16 posts Moshe Olshansky: 16 posts Petr PIKAL: 16 posts
show more
Archives